circad | circRNAs associated with diseases

circWDR77/hsa_circ_0013509
Gene	WDR77	Organism	Human
Genome Locus	chr1:111984646-111986543:-	Build	hg19
Disease	Cardiovascular Disease	ICD-10	Cardiovascular disease, unspecified (I51.6)
DBLink	Link to database	PMID	29042195
Experimental Method
Sample Type	Cell Lines	Comparison	Human VSMCs and HEK 293T cells
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCCAGCAACAGGACGAAATG Reverse TGGAGATCCTCGGACTGGAA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Chen, J, Cui, L, Yuan, J, Zhang, Y, Sang, H (2017). Circular RNA WDR77 target FGF-2 to regulate vascular smooth muscle cells proliferation and migration by sponging miR-124. Biochem. Biophys. Res. Commun., 494, 1-2:126-132.